rs488512 chr11:107858380 C>T
- Sequence
cgcggaacgccccagaggaccgac[C/T]taatagtgccacagggtgggtttc
- ASB in cell types
- GM12878 (female B-cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.75 | -1.78 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, hip bone mineral density (bmd), hypertension (early onset hypertension), neuroblastoma (brain cancer), premature ovarian failure, schizophrenia, urinary albumin-to-creatinine ratio, years of education