rs4889476 chr16:82152778 G>C
- Sequence
ctgctgagtcaccaccacatgacc[G/C]taaatccaaggtgacatatctatc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM6_HUMAN ZBT8A_HUMAN GLI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM6_HUMAN | 2.29 | -2.91 | 1.50 | n/a | No Hit | |||
| ZBT8A_HUMAN | 2.07 | -2.11 | 1.33 | n/a | n/a | |||
| GLI2_HUMAN | 2.03 | -1.96 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood