rs4890575 chr18:45689160 G>T
- Sequence
ccaacacattataacctctgaggg[G/T]ccagattatgtattttcatggccc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 1.30 | -1.03 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1