rs4905323 chr14:95452591 G>T
- Sequence
ctggaactcagcctttactgtctg[G/T]tgctgggctacagttctgctcttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) erythroid progenitors
- ASB for transcription factors
- RFX1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | n/a | 3.06 | 1.50 | 4.11 | Concordant | |||
| CTCF_HUMAN | 0.67 | 0.78 | 1.45 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
