rs4908165 chr1:101567983 C>T
- Sequence
aattttctttccttcagggtgggt[C/T]cagtccatacattctttatctagg
- ASB in cell types
- foreskin keratinocyte IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.96 | -0.78 | 1.83 | |||
| IPSC-derived bipolar neuron | 1.11 | -0.53 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hip bone mineral density (bmd), mitral annular calcium, systolic blood pressure (sbp), tetrology of fallot