rs4908749 chr1:8302982 C>A
- Sequence
gtgcttcaccactcattacataga[C/A]tattgagctcttgtgttgaatatt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.22 | 0.83 | 1.34 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting blood glucose, ldl cholesterol, serum creatinine, total cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Thyroid, Whole_Blood