rs4910440 chr11:9093452 C>T
- Sequence
agtaaggacataaattaataatga[C/T]aagaatcagcgcctttttgcctaa
- ASB in cell types
- foreskin keratinocyte pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.51 | 1.94 | 2.83 | |||
| pancreas | 1.15 | 0.18 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Prostate, Testis, Whole_Blood