rs4910735 chr11:5237622 G>A
- Sequence
ttgggaattgggattatacaggct[G/A]tatttaagagtttagatataactg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 2.44 | -3.50 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1