rs491750 chr12:57397393 G>T
- Sequence
cacccaagccctactgtgttctat[G/T]ctaaagtgagaatatccctaactc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 1.66 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, ldl cholesterol, microalbuminuria, serum creatinine, total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood