rs4933194 chr10:90751610 T>C
- Sequence
aggccaccagatggcattgtcaga[T/C]cattttacacctacttactgggaa
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.22 | -0.06 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 0.89 | 1.59 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.45 | 1.45 | 1.90 |
Items per page:
1 – 3 of 3