rs4942379 chr13:44922424 C>T
- Sequence
aagaacagctctggccagcacaaa[C/T]tcagcctatggcacaaggttaaac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.97 | -0.68 | 2.97 | |||
| SUM159PT (pleiomorphic breast carcinoma) | 1.79 | -0.79 | 3.33 |
Items per page:
1 – 2 of 2