rs4952435 chr2:41000484 T>A
- Sequence
gcctttaaaaaatctgagcatttg[T/A]aaaaacaaaaagcacagtaaacca
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.93 | 1.34 | 1.17 |
Items per page:
1 – 1 of 1