rs495392 chr13:33018055 C>A
- Sequence
taattttgacagcaggaaatattg[C/A]tatgccatggtaaagttgtctcaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.17 | 0.62 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, amyotrophic lateral sclerosis (als), fasting insulin, homa-ir, obesity with early age of onset (age >2), triglycerides