rs4960120 chr6:5646083 A>C
- Sequence
tgagataaggatgagttttcttag[A/C]ataagaagctagaactgacatgac
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | -0.11 | 2.32 | 2.00 | |||
| CD34+ bone marrow cell-derived erythroid progenitors | 1.34 | -1.69 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence