rs496183 chr18:36284743 T>A
- Sequence
actatatgagcaagtgattgaaca[T/A]ctctaagtcttactatgtctcatc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.36 | 0.71 | 2.57 | |||
| K562 (myelogenous leukemia) | 0.66 | -0.38 | 2.57 | |||
| B-cells | 1.84 | n/a | 2.00 |
Items per page:
1 – 3 of 3