rs4963123 chr11:919107 T>C
- Sequence
caccgggcccggccccggtggaca[T/C]cttgatcttggacttccagcctcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.61 | -0.27 | 2.03 | |||
| HEK293T (embryonic kidney) | -0.13 | 1.13 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood