rs496932 chr13:80359473 A>G
- Sequence
gaaaagccttgttgttctttacaa[A/G]taactcaggctgcctcagtcagtc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- PKNX1_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -2.96 | 2.76 | 1.33 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.78 | 1.52 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, mitral annular calcium, parkinsons disease, parkinsons disease (pd)