rs4969407 chr17:81149335 C>T
- Sequence
tccatcggactgccctggagtttc[C/T]caaccacacacagctgaggctagt
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.38 | n/a | 2.50 | -4.26 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellum, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood