rs4970379 chr1:940390 A>G
- Sequence
gggcgctgggccccgctgggatcg[A/G]tgcgggcggccgcgccggctgggc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HepG2 (hepatoblastoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- MEIS2_HUMAN ZN282_HUMAN CTCF_HUMAN ZN692_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.08 | 1.33 | n/a | No Hit | |||
| ZN282_HUMAN | -2.85 | 2.59 | 1.33 | n/a | n/a | |||
| CTCF_HUMAN | 0.29 | 0.82 | 1.51 | n/a | No Hit | |||
| ZN692_HUMAN | 2.33 | n/a | 2.00 | n/a | n/a | |||
| ZBT7A_HUMAN | -0.30 | 0.92 | 1.44 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood