rs4970821 chr1:108316692 T>C
- Sequence
agactgaagcagcccatttcatac[T/C]tctgctcccttaggacacatcctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.01 | 1.10 | 2.48 | |||
| foreskin keratinocyte | 2.54 | -0.90 | 2.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, ldl cholesterol change with statins, mitral annular calcium, total cholesterol
GTEx eQTL Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Esophagus_Muscularis, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis