rs497381 chr15:58444839 C>A
- Sequence
acacccagcaaacactttgctagg[C/A]cctgctgtgacccgggtcctgggc
- ASB in cell types
- liver
- ASB for transcription factors
- RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRA_HUMAN | -1.86 | 2.15 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, triglycerides, waist hip ratio