rs497857 chr13:80343392 T>C
- Sequence
agcgctgcaggaactttgcgaaga[T/C]acatcgttagggatcaaagcatgc
- ASB in cell types
- GM12878 (female B-cells) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.37 | 0.72 | 1.31 | |||
| RWPE2 | -2.24 | 1.97 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium