rs498156 chr11:95307742 C>T
- Sequence
ctctctccccacttcccctccctt[C/T]ggcttcagaaatgtccctttaagt
- ASB in cell types
- periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -2.98 | 1.58 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), ldl cholesterol, neuroblastoma (brain cancer), prop taste detection threshold, resistance to kuru in aged women despite likely exposure, stabilized warfarin dose, total cholesterol