rs498266 chr9:76692003 G>A
- Sequence
cagcagcaagagattagtctttga[G/A]aacaacactctccatctcattctg
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.45 | 0.94 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, body mass index (bmi)
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Heart_Left_Ventricle, Lung, Spleen, Whole_Blood