rs4984570 chr15:94858665 A>G
- Sequence
acaaataccacgtaagaacacggg[A/G]tggagagttaaggctcatctactc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | -0.12 | 1.99 |
Items per page:
1 – 1 of 1