rs499603 chr3:13073559 G>C
- Sequence
cagcagcatcaggcgcggccgctc[G/C]gctgcgccctcgcggcaaagtcac
- ASB in cell types
- neural cell GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.08 | 1.09 | 1.00 | |||
| GM23248 | -1.44 | 1.61 | 1.33 |
Items per page:
1 – 2 of 2