rs500063 chr11:107799502 T>C
- Sequence
cagaaaaacttaaggctgacattg[T/C]agtctatgacaatttggctctcag
- ASB in cell types
- neutrophils foreskin keratinocyte CD34+ hematopoietic stem cells T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 2.14 | -0.79 | 1.67 | |||
| foreskin keratinocyte | n/a | 0.48 | 2.50 | |||
| CD34+ hematopoietic stem cells | 1.91 | -1.38 | 2.00 | |||
| T47D (invasive ductal carcinoma) | -0.72 | 1.59 | 2.00 |
Items per page:
1 – 4 of 4