rs5000880 chr13:59442300 G>T
- Sequence
cacccacacattgcctacatatac[G/T]atacatacatacacacatacacat
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.91 | -0.06 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), hip bone mineral density (bmd), ldl cholesterol, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd), total cholesterol