rs500184 chr1:111620924 C>A
- Sequence
gggatctcctcttagggctgagaa[C/A]cagagtttagggaacctttgacct
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.74 | -0.22 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.47 | 0.49 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood