rs500422 chr2:218568272 C>A
- Sequence
cgagggtaatggaagtagggatac[C/A]gaacccaaaggagggaggccgcta
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293T (embryonic kidney) A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- LMBL2_HUMAN CREB1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | n/a | 0.82 | 2.00 | n/a | n/a | |||
| CREB1_HUMAN | 1.65 | -0.05 | 1.75 | n/a | No Hit | |||
| ZFX_HUMAN | 0.21 | 1.12 | 1.41 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood