rs5008484 chr6:75331356 T>A
- Sequence
gagattcactgagagggaactctc[T/A]gattacacactctagtatgaagct
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.13 | -2.36 | 1.33 | n/a | No Hit | |||
| JUND_HUMAN | 0.91 | -1.74 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Whole_Blood