rs501130 chr12:64779790 C>G
- Sequence
ttagcctcttcgtgcctcagctcc[C/G]tcagctgaaaagtgagaatataac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | -1.67 | 2.04 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, college completion, hdl cholesterol change with statins, serum creatinine, total cholesterol change with statins, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood