rs5023958 chr5:178086214 G>A
- Sequence
tctgcagttgcaatttacctgagt[G/A]ttctgtatttttatttgctaaatc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.79 | 1.02 | 3.49 | |||
| K562 (myelogenous leukemia) | 1.15 | -0.55 | 2.00 |
Items per page:
1 – 2 of 2