rs503601 chr11:79159836 C>T
- Sequence
tcattcatttacagatgccttcca[C/T]ttcctcttccaccacctgctggcc
- ASB in cell types
- VCaP (prostate carcinoma) NB69 (neuroblastoma) bipolar neuron PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -1.92 | 2.05 | 1.00 | |||
| NB69 (neuroblastoma) | -1.45 | 1.82 | 1.33 | |||
| bipolar neuron | -0.73 | 1.21 | 1.33 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | n/a | 1.61 | 1.00 |
Items per page:
1 – 4 of 4