rs504122 chr13:80337390 G>A
- Sequence
ccgtgcttatggatctggacagag[G/A]ggctcgtgcagaagaatggacctg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.04 | 0.75 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, late onset alzheimers disease, mitral annular calcium, parkinsons disease, parkinsons disease (pd), simpson-angus scale