rs504202 chr1:179941771 G>C
- Sequence
acactggaaagacttaaacaattg[G/C]gattaggaatacctggggcttctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | n/a | 0.80 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, irritible bowel syndrome, lp-pla2 activity, lp-pla2 mass, total cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Nerve_Tibial, Testis, Thyroid, Whole_Blood