rs504677 chr12:121167386 C>T
- Sequence
tatggttcttcaatcagcattttt[C/T]ctctaaaaaccttaagcaatcctg
- ASB in cell types
- K562 (myelogenous leukemia) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | -0.33 | 2.08 | |||
| macrophages | n/a | 1.84 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood