rs505141 chr1:10428257 A>G
- Sequence
gcaacactgacatctagtggccag[A/G]ttatagggctacttcttcatcaag
- ASB in cell types
- HEK293 (embryonic kidney) GM12868 (female B-cells) H929 (plasma cell myeloma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.84 | -0.22 | 1.97 | |||
| GM12868 (female B-cells) | 2.01 | n/a | 1.50 | |||
| H929 (plasma cell myeloma) | 1.45 | -1.71 | 1.33 | |||
| HeLa S3 (cervical adenocarcinoma) | 0.93 | -0.16 | 1.78 | |||
| cranial neural crest cells | 2.04 | -2.66 | 2.00 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood