rs507378 chr11:133947897 T>C
- Sequence
gcctatctgtcctgcgggctccat[T/C]tctgcatgtgtctgtccgtccatc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.55 | 0.17 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Pituitary, Prostate, Spleen, Testis, Thyroid, Whole_Blood