rs508594 chr1:111622549 T>G
- Sequence
tacccttccctgccactgtttcta[T/G]cctctcaccctaccttatactctt
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.58 | -0.12 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.34 | 0.33 | 1.32 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), college completion, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hypertension (early onset hypertension), resistance to kuru in aged women despite likely exposure
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood