rs509555 chr5:153496561 A>G
- Sequence
cagatcccaaagggggtactgggc[A/G]agttaggtggaaatggtggcctgg
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.22 | 1.32 | 1.57 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, birth weight, cognitive response to topiramate treatment as measured by the animals cognitive test, partial epilepsy, rheumatoid arthritis, triglycerides