rs512225 chr11:124669340 C>T
- Sequence
tggcagaagagggcaatagctgaa[C/T]ggaagatgggctgccttacctttc
- ASB in cell types
- osteoblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| osteoblasts | 2.00 | n/a | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, lp-pla2 activity, maternal transmission distortion, rheumatoid arthritis, systolic blood pressure (sbp)