rs512370 chr11:103042416 G>C
- Sequence
tggaggatagaatgtggattgtaa[G/C]aaagaagaggaaaacagtatcagc
- ASB in cell types
- primary endothelial colony-forming cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary endothelial colony-forming cells | -1.59 | 1.61 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, lp-pla2 activity, lp-pla2 mass, total cholesterol change with statins