rs513568 chr9:125649575 G>A
- Sequence
actaacgtctgaaggcaattcctt[G/A]gccagtttcaaggctggctgacaa
- ASB in cell types
- HAEC (human aortic endothelial cells) SK-N-SH (neuroblastoma) HUVEC (umbilical vein endothelial cells)
- ASB for transcription factors
- JUN_HUMAN FOS_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.36 | -3.32 | 2.00 | n/a | No Hit | |||
| FOS_HUMAN | -1.33 | 1.42 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol, salmonella-induced pyroptosis, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood