rs514398 chr3:13092363 C>G
- Sequence
gcagcgcgcggctgctgcaaagtc[C/G]tgcaaagagatacctgcaaaacac
- ASB in cell types
- kidney GM12878 (female B-cells) lymphoblastoid cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| kidney | 2.29 | -2.11 | 2.00 | |||
| GM12878 (female B-cells) | 0.51 | 0.64 | 1.28 | |||
| lymphoblastoid cells | -0.97 | 1.39 | 1.33 |
Items per page:
1 – 3 of 3