rs5158 chr19:44943921 C>T
- Sequence
acacagctagctacatgtggcccc[C/T]gcgtgacggctggtctctgtaggc
- ASB in cell types
- monocyte-derived macrophages periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.41 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, late onset alzheimers disease, ldl cholesterol, microalbuminuria, rheumatoid arthritis, total cholesterol, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis