rs518136 chr7:17041533 G>A
- Sequence
aggtttcctgcttaatttagttcc[G/A]tcaactgattgccatggaaactct
- ASB in cell types
- tibial nerve HAEC (human aortic endothelial cells) periferal blood macrophages
- ASB for transcription factors
- EP300_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.68 | -0.13 | 1.54 | n/a | n/a | |||
| SPI1_HUMAN | 1.04 | 0.07 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2