rs518758 chr3:185559425 G>A
- Sequence
actaaaaatacaaaaaaattagcc[G/A]ggcgtggtggcaggtgcctgtaat
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.00 | -1.15 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 0.46 | 1.64 | 1.50 |
Items per page:
1 – 2 of 2