rs521191 chr11:95151209 C>A
- Sequence
ctcggaccagtgcgcggggaggat[C/A]ccgctaacgccgggcgcctgcaga
- ASB in cell types
- RWPE2 erythroid cells K562 (myelogenous leukemia) SK-BR-3 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | 1.69 | -1.59 | 1.00 | |||
| erythroid cells | -3.88 | 2.50 | 2.00 | |||
| K562 (myelogenous leukemia) | -0.36 | 0.76 | 2.00 | |||
| SK-BR-3 (breast adenocarcinoma) | n/a | 1.23 | 1.33 | |||
| LNCaP C4-2B (prostate carcinoma) | 1.23 | -0.14 | 1.11 |
Items per page:
1 – 5 of 6