rs523223 chr11:119892708 G>A
- Sequence
gcgggcctctgcagacgcaatgcc[G/A]tctgcgctccgtccactgaaaagc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.12 | -0.20 | 1.22 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, hdl cholesterol change with statins, infant head circumference, total cholesterol change with statins